Review



e coli rnap core enzyme  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    New England Biolabs e coli rnap core enzyme
    Several RNAs transcribed by the sibD minimal promoter from <t>E.</t> <t>coli</t> chromosomal DNA could be NAD capped. ( A ) Schematic illustration of gene editing designs in the E. coli genome for four small RNAs expression driven by the sibD minimal promoter. The gene body of trpT is highlighted in purple, sroC in green, and ryjA and symR in blue. The sibD minimal promoter ( sibD P-35 ) is labelled as a short red line, and the rrnB terminator is highlighted in yellow. ( B ) Detection of NAD caps in SibD, TrpT, RyjA, SroC, and SymR RNAs with NADbio-northern blotting in the wild-type and indicated mutant strains. ‘ADPRC+’ indicates the biotinylation of NAD-RNAs via the ADPRC-SPAAC reaction with sufficient ADPRC, while ‘ADPRC−’ denotes the ADPRC-SPAAC reaction without ADPRC. 5S RNAs were detected as loading controls. ( C ) Detection and quantification of NAD-RNAs from SibD, TrpT, RyjA, SroC, and SymR using APB gel blotting. Capping ratios were calculated based on the band intensity of the capped transcripts relative to the total transcripts (both capped and uncapped transcripts) in the APB gel.
    E Coli Rnap Core Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 89 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/e+coli+rnap+core+enzyme/E%2Ecoli+RNA+Polymerase%2C+Core+Enzyme/pmc12956327-111-26-31
    Average 95 stars, based on 89 article reviews
    e coli rnap core enzyme - by Bioz Stars, 2026-09
    95/100 stars

    Images

    1) Product Images from "NAD + capping of sibD transcripts in E. coli is mediated by its minimal promoter and enhanced by ppGpp"

    Article Title: NAD + capping of sibD transcripts in E. coli is mediated by its minimal promoter and enhanced by ppGpp

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkag102

    Several RNAs transcribed by the sibD minimal promoter from E. coli chromosomal DNA could be NAD capped. ( A ) Schematic illustration of gene editing designs in the E. coli genome for four small RNAs expression driven by the sibD minimal promoter. The gene body of trpT is highlighted in purple, sroC in green, and ryjA and symR in blue. The sibD minimal promoter ( sibD P-35 ) is labelled as a short red line, and the rrnB terminator is highlighted in yellow. ( B ) Detection of NAD caps in SibD, TrpT, RyjA, SroC, and SymR RNAs with NADbio-northern blotting in the wild-type and indicated mutant strains. ‘ADPRC+’ indicates the biotinylation of NAD-RNAs via the ADPRC-SPAAC reaction with sufficient ADPRC, while ‘ADPRC−’ denotes the ADPRC-SPAAC reaction without ADPRC. 5S RNAs were detected as loading controls. ( C ) Detection and quantification of NAD-RNAs from SibD, TrpT, RyjA, SroC, and SymR using APB gel blotting. Capping ratios were calculated based on the band intensity of the capped transcripts relative to the total transcripts (both capped and uncapped transcripts) in the APB gel.
    Figure Legend Snippet: Several RNAs transcribed by the sibD minimal promoter from E. coli chromosomal DNA could be NAD capped. ( A ) Schematic illustration of gene editing designs in the E. coli genome for four small RNAs expression driven by the sibD minimal promoter. The gene body of trpT is highlighted in purple, sroC in green, and ryjA and symR in blue. The sibD minimal promoter ( sibD P-35 ) is labelled as a short red line, and the rrnB terminator is highlighted in yellow. ( B ) Detection of NAD caps in SibD, TrpT, RyjA, SroC, and SymR RNAs with NADbio-northern blotting in the wild-type and indicated mutant strains. ‘ADPRC+’ indicates the biotinylation of NAD-RNAs via the ADPRC-SPAAC reaction with sufficient ADPRC, while ‘ADPRC−’ denotes the ADPRC-SPAAC reaction without ADPRC. 5S RNAs were detected as loading controls. ( C ) Detection and quantification of NAD-RNAs from SibD, TrpT, RyjA, SroC, and SymR using APB gel blotting. Capping ratios were calculated based on the band intensity of the capped transcripts relative to the total transcripts (both capped and uncapped transcripts) in the APB gel.

    Techniques Used: Expressing, Northern Blot, Mutagenesis

    Effects of (p)ppGpp and DksA on transcription and NAD capping of certain small RNAs in E. coli cells. ( A ) The NAD capping level of SibD increased upon transient induction of RelA 455aa and DksA. Both RelA 455aa and DksA were expressed from plasmids under the control of the pBAD promoter. NAD capping of SibD was assessed by APB gel blotting. The total level of SibD RNA in each lane was quantified from the normal gel using ImageJ software and normalized to the intensity in the first EV lane. The NAD capping ratio was calculated as the percentage of the intensity of the NAD-capped band relative to the sum of the intensities of both the capped and uncapped bands in the APB gel. ‘Arabinose−’ indicates RNA samples without arabinose induction, while ‘Arabinose+’ signifies that arabinose was added to induce the expression of RelA 455aa and DksA. ‘EV’ indicates strain carrying the empty pBAD33.1 vector. The tmRNA was used as a loading control and each blotting has three independent replicates. ( B ) Detection of NAD-capped transcripts of five sRNAs with NADbio-northern blotting analysis, including four known NAD-RNAs: SibC, SibD, SibE, and GcvB. The tmRNA was used as a loading control. ( C – G ) Detection of total transcripts and NAD-capped transcripts of five sRNAs, namely SibA, SibC, SibD, SibE, and GcvB, respectively. The total abundance of individual RNA was determined by electrophoresis on a standard PAGE gel followed by northern blotting (labelled as normal gel), while the NAD-capped transcripts were identified with APB gel blotting (labelled as APB gel). The non-NAD-RNA SibA was included as a negative control. The NAD capping ratio was calculated based on the band intensity of the NAD-capped version relative to the total transcription levels (NAD-capped version plus uncapped version). Two types of synthetic RNAs for each sRNA, namely with 5′-ppp- and 5′-NAD modifications, were used as controls.
    Figure Legend Snippet: Effects of (p)ppGpp and DksA on transcription and NAD capping of certain small RNAs in E. coli cells. ( A ) The NAD capping level of SibD increased upon transient induction of RelA 455aa and DksA. Both RelA 455aa and DksA were expressed from plasmids under the control of the pBAD promoter. NAD capping of SibD was assessed by APB gel blotting. The total level of SibD RNA in each lane was quantified from the normal gel using ImageJ software and normalized to the intensity in the first EV lane. The NAD capping ratio was calculated as the percentage of the intensity of the NAD-capped band relative to the sum of the intensities of both the capped and uncapped bands in the APB gel. ‘Arabinose−’ indicates RNA samples without arabinose induction, while ‘Arabinose+’ signifies that arabinose was added to induce the expression of RelA 455aa and DksA. ‘EV’ indicates strain carrying the empty pBAD33.1 vector. The tmRNA was used as a loading control and each blotting has three independent replicates. ( B ) Detection of NAD-capped transcripts of five sRNAs with NADbio-northern blotting analysis, including four known NAD-RNAs: SibC, SibD, SibE, and GcvB. The tmRNA was used as a loading control. ( C – G ) Detection of total transcripts and NAD-capped transcripts of five sRNAs, namely SibA, SibC, SibD, SibE, and GcvB, respectively. The total abundance of individual RNA was determined by electrophoresis on a standard PAGE gel followed by northern blotting (labelled as normal gel), while the NAD-capped transcripts were identified with APB gel blotting (labelled as APB gel). The non-NAD-RNA SibA was included as a negative control. The NAD capping ratio was calculated based on the band intensity of the NAD-capped version relative to the total transcription levels (NAD-capped version plus uncapped version). Two types of synthetic RNAs for each sRNA, namely with 5′-ppp- and 5′-NAD modifications, were used as controls.

    Techniques Used: Control, Software, Expressing, Plasmid Preparation, Northern Blot, Electrophoresis, Negative Control

    Related Articles

    Incubation:

    Article Title: Head-on and co-directional RNA polymerase collisions orchestrate bidirectional transcription termination.
    Article Snippet: The template DNA strand (5’-CTCTGAATCTCTTCCCCTCTAGCTTAGGACGTACTGACC), non-template DNA strand (5’-GGTCAGT ACGTCCATTCGATCTCCCGAAGAGATTCAGAG), 15-nt Cy3-RNA (5’-AGCUAGA*G*G*UUUUUU; * denotes the phosphorothioate linkage designed to minimize cleavage by the intrinsic endonuclease activity of RNAP), and 11-nt Cy3-RNA (5’-AGCUAGA*G*G*UU) were synthesized by IDT. .. The two DNA strands were mixed and annealed in a buffer (10 mM Tris-HCl pH 8.0, 40 mM KCl, 5 mM MgCl2) by raising the temperature to 95 C for 5 min and then slowly cooling down to 50 C. Then an equal volume of the RNA strand was added and annealed to the DNA scaffold by incubating at 50 C for 5 min and then slowly cooling down to 25 C. The annealed DNA:RNA scaffolds were mixed with E. coli RNAP core enzyme (New England Biolabs) at 1:1 (vol/vol) and incubated at 37 C for 10min to form long-backtracked (using 15-nt Cy3-RNA) and short-backtracked (using 11-nt Cy3-RNA) ECs. ..

    Article Title: Compositions and methods for transcription-based CRISPR-Cas DNA editing
    Article Snippet: Typically, 2 μl 1 pmol/μl of template strand (TS) and 1 μl of 4 pmol/l RNA oligos were mixed in 1× transcription buffer and incubated at 65° C. for 5 min, followed by gradual cooling to room temperature. .. After addition of 1.5 μl E. coli RNAP core enzyme (NEB), the reaction was incubated at 25° C. for 25-30 min and at 37° C. for 1 min. Then, 4 μl 1.25 pmol/μl non template strand (NTS) (pretreated by heating to 65° C. for 5 min, then on ice for 2 min, and finally at 37° C. for 2 min) was added and incubated for 10-15 min at 37° C. The final concentration of TS was 0.10 pmol/μl after adding supplement buffer to obtain transcription conditions. ..

    Transformation Assay:

    Article Title: Structural and mechanistic basis of reiterative transcription initiation
    Article Snippet: Bpa-containing E. coli RNAP core enzyme derivatives RNAP - β’ R1148Bpa and RNAP - β’ T48Bpa were prepared from E. coli strain NiCo21(DE3) (New England Biolabs, Inc.) transformed with plasmid pEVOL-pBpF ( ) and either plasmid pIA900-RNAP - β’ R1148Bpa ( ) or plasmid pIA900-RNAP - β’ T48Bpa , using procedures as in ( ). .. E. coli RNAP core enzyme without Bpa was prepared from E. coli strain NiCo21(DE3) (New England Biolabs, Inc.) transformed with plasmid pIA900 , using procedures as in ( ). ..

    Article Title: Structural and mechanistic basis of reiterative transcription initiation
    Article Snippet: Bpa-containing E. coli RNAP core enzyme derivatives RNAP-β' R1148Bpa and RNAP-β' T48Bpa were prepared from E. coli strain NiCo21(DE3) (New England Biolabs, Inc.) transformed with plasmid pEVOL-pBpF (3) and either plasmid pIA900-RNAP-β' R1148Bpa (4) or plasmid pIA900-RNAP-β' T48Bpa (4), using procedures as in (4). .. E. coli RNAP core enzyme without Bpa was prepared from E. coli strain NiCo21(DE3) (New England Biolabs, Inc.) transformed with plasmid pIA900 (5), using procedures as in (4). ..

    Article Title: Promoter-sequence determinants and structural basis of primer-dependent transcription initiation in Escherichia coli
    Article Snippet: .. E. coli RNAP core enzyme used in transcription experiments was prepared from E. coli strain NiCo21(DE3) (New England Biolabs, NEB) transformed with plasmid pIA900 ( ) using culture and induction procedures, immobilized-metal-ion affinity chromatography on Ni-NTA agarose, and affinity chromatography on Heparin HP as described in ( ). ..

    Plasmid Preparation:

    Article Title: Structural and mechanistic basis of reiterative transcription initiation
    Article Snippet: Bpa-containing E. coli RNAP core enzyme derivatives RNAP - β’ R1148Bpa and RNAP - β’ T48Bpa were prepared from E. coli strain NiCo21(DE3) (New England Biolabs, Inc.) transformed with plasmid pEVOL-pBpF ( ) and either plasmid pIA900-RNAP - β’ R1148Bpa ( ) or plasmid pIA900-RNAP - β’ T48Bpa , using procedures as in ( ). .. E. coli RNAP core enzyme without Bpa was prepared from E. coli strain NiCo21(DE3) (New England Biolabs, Inc.) transformed with plasmid pIA900 , using procedures as in ( ). ..

    Article Title: Structural and mechanistic basis of reiterative transcription initiation
    Article Snippet: Bpa-containing E. coli RNAP core enzyme derivatives RNAP-β' R1148Bpa and RNAP-β' T48Bpa were prepared from E. coli strain NiCo21(DE3) (New England Biolabs, Inc.) transformed with plasmid pEVOL-pBpF (3) and either plasmid pIA900-RNAP-β' R1148Bpa (4) or plasmid pIA900-RNAP-β' T48Bpa (4), using procedures as in (4). .. E. coli RNAP core enzyme without Bpa was prepared from E. coli strain NiCo21(DE3) (New England Biolabs, Inc.) transformed with plasmid pIA900 (5), using procedures as in (4). ..

    Article Title: Promoter-sequence determinants and structural basis of primer-dependent transcription initiation in Escherichia coli
    Article Snippet: .. E. coli RNAP core enzyme used in transcription experiments was prepared from E. coli strain NiCo21(DE3) (New England Biolabs, NEB) transformed with plasmid pIA900 ( ) using culture and induction procedures, immobilized-metal-ion affinity chromatography on Ni-NTA agarose, and affinity chromatography on Heparin HP as described in ( ). ..

    Concentration Assay:

    Article Title: Compositions and methods for transcription-based CRISPR-Cas DNA editing
    Article Snippet: Typically, 2 μl 1 pmol/μl of template strand (TS) and 1 μl of 4 pmol/l RNA oligos were mixed in 1× transcription buffer and incubated at 65° C. for 5 min, followed by gradual cooling to room temperature. .. After addition of 1.5 μl E. coli RNAP core enzyme (NEB), the reaction was incubated at 25° C. for 25-30 min and at 37° C. for 1 min. Then, 4 μl 1.25 pmol/μl non template strand (NTS) (pretreated by heating to 65° C. for 5 min, then on ice for 2 min, and finally at 37° C. for 2 min) was added and incubated for 10-15 min at 37° C. The final concentration of TS was 0.10 pmol/μl after adding supplement buffer to obtain transcription conditions. ..

    Affinity Chromatography:

    Article Title: Promoter-sequence determinants and structural basis of primer-dependent transcription initiation in Escherichia coli
    Article Snippet: .. E. coli RNAP core enzyme used in transcription experiments was prepared from E. coli strain NiCo21(DE3) (New England Biolabs, NEB) transformed with plasmid pIA900 ( ) using culture and induction procedures, immobilized-metal-ion affinity chromatography on Ni-NTA agarose, and affinity chromatography on Heparin HP as described in ( ). ..



    Similar Products

    e coli rnap core enzyme  (New England Biolabs)
    95
    New England Biolabs e coli rnap core enzyme
    Several RNAs transcribed by the sibD minimal promoter from <t>E.</t> <t>coli</t> chromosomal DNA could be NAD capped. ( A ) Schematic illustration of gene editing designs in the E. coli genome for four small RNAs expression driven by the sibD minimal promoter. The gene body of trpT is highlighted in purple, sroC in green, and ryjA and symR in blue. The sibD minimal promoter ( sibD P-35 ) is labelled as a short red line, and the rrnB terminator is highlighted in yellow. ( B ) Detection of NAD caps in SibD, TrpT, RyjA, SroC, and SymR RNAs with NADbio-northern blotting in the wild-type and indicated mutant strains. ‘ADPRC+’ indicates the biotinylation of NAD-RNAs via the ADPRC-SPAAC reaction with sufficient ADPRC, while ‘ADPRC−’ denotes the ADPRC-SPAAC reaction without ADPRC. 5S RNAs were detected as loading controls. ( C ) Detection and quantification of NAD-RNAs from SibD, TrpT, RyjA, SroC, and SymR using APB gel blotting. Capping ratios were calculated based on the band intensity of the capped transcripts relative to the total transcripts (both capped and uncapped transcripts) in the APB gel.
    E Coli Rnap Core Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/e+coli+rnap+core+enzyme/E%2Ecoli+RNA+Polymerase%2C+Core+Enzyme/pmc12956327-111-26-31
    Average 95 stars, based on 1 article reviews
    e coli rnap core enzyme - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    pvs10 dαctd plasmid expressing e coli rnap core enzyme  (Addgene inc)
    92
    Addgene inc pvs10 dαctd plasmid expressing e coli rnap core enzyme
    Several RNAs transcribed by the sibD minimal promoter from <t>E.</t> <t>coli</t> chromosomal DNA could be NAD capped. ( A ) Schematic illustration of gene editing designs in the E. coli genome for four small RNAs expression driven by the sibD minimal promoter. The gene body of trpT is highlighted in purple, sroC in green, and ryjA and symR in blue. The sibD minimal promoter ( sibD P-35 ) is labelled as a short red line, and the rrnB terminator is highlighted in yellow. ( B ) Detection of NAD caps in SibD, TrpT, RyjA, SroC, and SymR RNAs with NADbio-northern blotting in the wild-type and indicated mutant strains. ‘ADPRC+’ indicates the biotinylation of NAD-RNAs via the ADPRC-SPAAC reaction with sufficient ADPRC, while ‘ADPRC−’ denotes the ADPRC-SPAAC reaction without ADPRC. 5S RNAs were detected as loading controls. ( C ) Detection and quantification of NAD-RNAs from SibD, TrpT, RyjA, SroC, and SymR using APB gel blotting. Capping ratios were calculated based on the band intensity of the capped transcripts relative to the total transcripts (both capped and uncapped transcripts) in the APB gel.
    Pvs10 Dαctd Plasmid Expressing E Coli Rnap Core Enzyme, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/e+coli+rnap+core+enzyme/PVS10+(Plasmid+%23104398)/pmc10853779__gkad1231_supplemental_file-43-1-0
    Average 92 stars, based on 1 article reviews
    pvs10 dαctd plasmid expressing e coli rnap core enzyme - by Bioz Stars, 2026-09
    92/100 stars
    		  Buy from Supplier
    e. coli rnap core enzyme  (Thermo Fisher)
    90
    Thermo Fisher e. coli rnap core enzyme
    Several RNAs transcribed by the sibD minimal promoter from <t>E.</t> <t>coli</t> chromosomal DNA could be NAD capped. ( A ) Schematic illustration of gene editing designs in the E. coli genome for four small RNAs expression driven by the sibD minimal promoter. The gene body of trpT is highlighted in purple, sroC in green, and ryjA and symR in blue. The sibD minimal promoter ( sibD P-35 ) is labelled as a short red line, and the rrnB terminator is highlighted in yellow. ( B ) Detection of NAD caps in SibD, TrpT, RyjA, SroC, and SymR RNAs with NADbio-northern blotting in the wild-type and indicated mutant strains. ‘ADPRC+’ indicates the biotinylation of NAD-RNAs via the ADPRC-SPAAC reaction with sufficient ADPRC, while ‘ADPRC−’ denotes the ADPRC-SPAAC reaction without ADPRC. 5S RNAs were detected as loading controls. ( C ) Detection and quantification of NAD-RNAs from SibD, TrpT, RyjA, SroC, and SymR using APB gel blotting. Capping ratios were calculated based on the band intensity of the capped transcripts relative to the total transcripts (both capped and uncapped transcripts) in the APB gel.
    E. Coli Rnap Core Enzyme, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/e+coli+rnap+core+enzyme/pm37238608-41-0-12
    Average 90 stars, based on 1 article reviews
    e. coli rnap core enzyme - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    rnap core enzyme  (New England Biolabs)
    95
    New England Biolabs rnap core enzyme
    Several RNAs transcribed by the sibD minimal promoter from <t>E.</t> <t>coli</t> chromosomal DNA could be NAD capped. ( A ) Schematic illustration of gene editing designs in the E. coli genome for four small RNAs expression driven by the sibD minimal promoter. The gene body of trpT is highlighted in purple, sroC in green, and ryjA and symR in blue. The sibD minimal promoter ( sibD P-35 ) is labelled as a short red line, and the rrnB terminator is highlighted in yellow. ( B ) Detection of NAD caps in SibD, TrpT, RyjA, SroC, and SymR RNAs with NADbio-northern blotting in the wild-type and indicated mutant strains. ‘ADPRC+’ indicates the biotinylation of NAD-RNAs via the ADPRC-SPAAC reaction with sufficient ADPRC, while ‘ADPRC−’ denotes the ADPRC-SPAAC reaction without ADPRC. 5S RNAs were detected as loading controls. ( C ) Detection and quantification of NAD-RNAs from SibD, TrpT, RyjA, SroC, and SymR using APB gel blotting. Capping ratios were calculated based on the band intensity of the capped transcripts relative to the total transcripts (both capped and uncapped transcripts) in the APB gel.
    Rnap Core Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/e+coli+rnap+core+enzyme/E%2Ecoli+RNA+Polymerase%2C+Core+Enzyme/pmc10120043__pnas__2219290120__sapp-43-0-12
    Average 95 stars, based on 1 article reviews
    rnap core enzyme - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    e. coli rnap core enzyme  (Novoprotein)
    90
    Novoprotein e. coli rnap core enzyme
    (A) The sequences of the nucleic-acid scaffold used <t>for</t> <t>cryo-EM</t> study. (B) The cryo-EM map (left) and structural model (right) for TTC-pause complex. The <t>RNAP</t> subunits and nucleic-acid chains are colored as in the color scheme. (C) The cryo-EM map for the nucleic-acid scaffold. (D) The comparison of the RNA–DNA translocation states among TTC-pause complex, half-translocation state in a hairpin-stabilized paused transcription elongation complex ( his PEC; PDB: 6ASX), a pre-translocation complex (PDB: 4YLN), and a post-translocation complex (PDB: 6XLN). (E) The consensus sequence of bacterial intrinsic terminators (upper panel) and the schematic presentation of the nucleotides of the transcription bubble in the TTC-pause complex. (F) The conformational comparison among TTC-pause complex, TEC (PDB: 6ALF), and his PEC (PDB: 6ASX). (G) The cryo-EM map and structural model of ntDNA of the transcription bubble. The insert shows the interaction between the flipped A (–4) nucleotide and the ‘NT–4’ pocket.
    E. Coli Rnap Core Enzyme, supplied by Novoprotein, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/e+coli+rnap+core+enzyme/e++coli+rnap+core+enzyme/bio_rxiv__2022__08__30__505822-102-0-18
    Average 90 stars, based on 1 article reviews
    e. coli rnap core enzyme - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    rnap core enzyme derivatives  (New England Biolabs)
    95
    New England Biolabs rnap core enzyme derivatives
    (A) The sequences of the nucleic-acid scaffold used <t>for</t> <t>cryo-EM</t> study. (B) The cryo-EM map (left) and structural model (right) for TTC-pause complex. The <t>RNAP</t> subunits and nucleic-acid chains are colored as in the color scheme. (C) The cryo-EM map for the nucleic-acid scaffold. (D) The comparison of the RNA–DNA translocation states among TTC-pause complex, half-translocation state in a hairpin-stabilized paused transcription elongation complex ( his PEC; PDB: 6ASX), a pre-translocation complex (PDB: 4YLN), and a post-translocation complex (PDB: 6XLN). (E) The consensus sequence of bacterial intrinsic terminators (upper panel) and the schematic presentation of the nucleotides of the transcription bubble in the TTC-pause complex. (F) The conformational comparison among TTC-pause complex, TEC (PDB: 6ALF), and his PEC (PDB: 6ASX). (G) The cryo-EM map and structural model of ntDNA of the transcription bubble. The insert shows the interaction between the flipped A (–4) nucleotide and the ‘NT–4’ pocket.
    Rnap Core Enzyme Derivatives, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/e+coli+rnap+core+enzyme/E%2Ecoli+RNA+Polymerase%2C+Core+Enzyme/pmc09191641__pnas__2201301119__sapp-30-1-15
    Average 95 stars, based on 1 article reviews
    rnap core enzyme derivatives - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier

    Image Search Results


    Several RNAs transcribed by the sibD minimal promoter from E. coli chromosomal DNA could be NAD capped. ( A ) Schematic illustration of gene editing designs in the E. coli genome for four small RNAs expression driven by the sibD minimal promoter. The gene body of trpT is highlighted in purple, sroC in green, and ryjA and symR in blue. The sibD minimal promoter ( sibD P-35 ) is labelled as a short red line, and the rrnB terminator is highlighted in yellow. ( B ) Detection of NAD caps in SibD, TrpT, RyjA, SroC, and SymR RNAs with NADbio-northern blotting in the wild-type and indicated mutant strains. ‘ADPRC+’ indicates the biotinylation of NAD-RNAs via the ADPRC-SPAAC reaction with sufficient ADPRC, while ‘ADPRC−’ denotes the ADPRC-SPAAC reaction without ADPRC. 5S RNAs were detected as loading controls. ( C ) Detection and quantification of NAD-RNAs from SibD, TrpT, RyjA, SroC, and SymR using APB gel blotting. Capping ratios were calculated based on the band intensity of the capped transcripts relative to the total transcripts (both capped and uncapped transcripts) in the APB gel.

    Journal: Nucleic Acids Research

    Article Title: NAD + capping of sibD transcripts in E. coli is mediated by its minimal promoter and enhanced by ppGpp

    doi: 10.1093/nar/gkag102

    Figure Lengend Snippet: Several RNAs transcribed by the sibD minimal promoter from E. coli chromosomal DNA could be NAD capped. ( A ) Schematic illustration of gene editing designs in the E. coli genome for four small RNAs expression driven by the sibD minimal promoter. The gene body of trpT is highlighted in purple, sroC in green, and ryjA and symR in blue. The sibD minimal promoter ( sibD P-35 ) is labelled as a short red line, and the rrnB terminator is highlighted in yellow. ( B ) Detection of NAD caps in SibD, TrpT, RyjA, SroC, and SymR RNAs with NADbio-northern blotting in the wild-type and indicated mutant strains. ‘ADPRC+’ indicates the biotinylation of NAD-RNAs via the ADPRC-SPAAC reaction with sufficient ADPRC, while ‘ADPRC−’ denotes the ADPRC-SPAAC reaction without ADPRC. 5S RNAs were detected as loading controls. ( C ) Detection and quantification of NAD-RNAs from SibD, TrpT, RyjA, SroC, and SymR using APB gel blotting. Capping ratios were calculated based on the band intensity of the capped transcripts relative to the total transcripts (both capped and uncapped transcripts) in the APB gel.

    Article Snippet: To perform IVT assays with various sigma factors, a similar assay was conducted, except the E. coli RNAP holoenzyme was replaced by the same amount of E. coli RNAP core enzyme (NEB) and in the absence of ppGpp or DksA.

    Techniques: Expressing, Northern Blot, Mutagenesis

    Effects of (p)ppGpp and DksA on transcription and NAD capping of certain small RNAs in E. coli cells. ( A ) The NAD capping level of SibD increased upon transient induction of RelA 455aa and DksA. Both RelA 455aa and DksA were expressed from plasmids under the control of the pBAD promoter. NAD capping of SibD was assessed by APB gel blotting. The total level of SibD RNA in each lane was quantified from the normal gel using ImageJ software and normalized to the intensity in the first EV lane. The NAD capping ratio was calculated as the percentage of the intensity of the NAD-capped band relative to the sum of the intensities of both the capped and uncapped bands in the APB gel. ‘Arabinose−’ indicates RNA samples without arabinose induction, while ‘Arabinose+’ signifies that arabinose was added to induce the expression of RelA 455aa and DksA. ‘EV’ indicates strain carrying the empty pBAD33.1 vector. The tmRNA was used as a loading control and each blotting has three independent replicates. ( B ) Detection of NAD-capped transcripts of five sRNAs with NADbio-northern blotting analysis, including four known NAD-RNAs: SibC, SibD, SibE, and GcvB. The tmRNA was used as a loading control. ( C – G ) Detection of total transcripts and NAD-capped transcripts of five sRNAs, namely SibA, SibC, SibD, SibE, and GcvB, respectively. The total abundance of individual RNA was determined by electrophoresis on a standard PAGE gel followed by northern blotting (labelled as normal gel), while the NAD-capped transcripts were identified with APB gel blotting (labelled as APB gel). The non-NAD-RNA SibA was included as a negative control. The NAD capping ratio was calculated based on the band intensity of the NAD-capped version relative to the total transcription levels (NAD-capped version plus uncapped version). Two types of synthetic RNAs for each sRNA, namely with 5′-ppp- and 5′-NAD modifications, were used as controls.

    Journal: Nucleic Acids Research

    Article Title: NAD + capping of sibD transcripts in E. coli is mediated by its minimal promoter and enhanced by ppGpp

    doi: 10.1093/nar/gkag102

    Figure Lengend Snippet: Effects of (p)ppGpp and DksA on transcription and NAD capping of certain small RNAs in E. coli cells. ( A ) The NAD capping level of SibD increased upon transient induction of RelA 455aa and DksA. Both RelA 455aa and DksA were expressed from plasmids under the control of the pBAD promoter. NAD capping of SibD was assessed by APB gel blotting. The total level of SibD RNA in each lane was quantified from the normal gel using ImageJ software and normalized to the intensity in the first EV lane. The NAD capping ratio was calculated as the percentage of the intensity of the NAD-capped band relative to the sum of the intensities of both the capped and uncapped bands in the APB gel. ‘Arabinose−’ indicates RNA samples without arabinose induction, while ‘Arabinose+’ signifies that arabinose was added to induce the expression of RelA 455aa and DksA. ‘EV’ indicates strain carrying the empty pBAD33.1 vector. The tmRNA was used as a loading control and each blotting has three independent replicates. ( B ) Detection of NAD-capped transcripts of five sRNAs with NADbio-northern blotting analysis, including four known NAD-RNAs: SibC, SibD, SibE, and GcvB. The tmRNA was used as a loading control. ( C – G ) Detection of total transcripts and NAD-capped transcripts of five sRNAs, namely SibA, SibC, SibD, SibE, and GcvB, respectively. The total abundance of individual RNA was determined by electrophoresis on a standard PAGE gel followed by northern blotting (labelled as normal gel), while the NAD-capped transcripts were identified with APB gel blotting (labelled as APB gel). The non-NAD-RNA SibA was included as a negative control. The NAD capping ratio was calculated based on the band intensity of the NAD-capped version relative to the total transcription levels (NAD-capped version plus uncapped version). Two types of synthetic RNAs for each sRNA, namely with 5′-ppp- and 5′-NAD modifications, were used as controls.

    Article Snippet: To perform IVT assays with various sigma factors, a similar assay was conducted, except the E. coli RNAP holoenzyme was replaced by the same amount of E. coli RNAP core enzyme (NEB) and in the absence of ppGpp or DksA.

    Techniques: Control, Software, Expressing, Plasmid Preparation, Northern Blot, Electrophoresis, Negative Control

    (A) The sequences of the nucleic-acid scaffold used for cryo-EM study. (B) The cryo-EM map (left) and structural model (right) for TTC-pause complex. The RNAP subunits and nucleic-acid chains are colored as in the color scheme. (C) The cryo-EM map for the nucleic-acid scaffold. (D) The comparison of the RNA–DNA translocation states among TTC-pause complex, half-translocation state in a hairpin-stabilized paused transcription elongation complex ( his PEC; PDB: 6ASX), a pre-translocation complex (PDB: 4YLN), and a post-translocation complex (PDB: 6XLN). (E) The consensus sequence of bacterial intrinsic terminators (upper panel) and the schematic presentation of the nucleotides of the transcription bubble in the TTC-pause complex. (F) The conformational comparison among TTC-pause complex, TEC (PDB: 6ALF), and his PEC (PDB: 6ASX). (G) The cryo-EM map and structural model of ntDNA of the transcription bubble. The insert shows the interaction between the flipped A (–4) nucleotide and the ‘NT–4’ pocket.

    Journal: bioRxiv

    Article Title: Structural basis for intrinsic transcription termination

    doi: 10.1101/2022.08.30.505822

    Figure Lengend Snippet: (A) The sequences of the nucleic-acid scaffold used for cryo-EM study. (B) The cryo-EM map (left) and structural model (right) for TTC-pause complex. The RNAP subunits and nucleic-acid chains are colored as in the color scheme. (C) The cryo-EM map for the nucleic-acid scaffold. (D) The comparison of the RNA–DNA translocation states among TTC-pause complex, half-translocation state in a hairpin-stabilized paused transcription elongation complex ( his PEC; PDB: 6ASX), a pre-translocation complex (PDB: 4YLN), and a post-translocation complex (PDB: 6XLN). (E) The consensus sequence of bacterial intrinsic terminators (upper panel) and the schematic presentation of the nucleotides of the transcription bubble in the TTC-pause complex. (F) The conformational comparison among TTC-pause complex, TEC (PDB: 6ALF), and his PEC (PDB: 6ASX). (G) The cryo-EM map and structural model of ntDNA of the transcription bubble. The insert shows the interaction between the flipped A (–4) nucleotide and the ‘NT–4’ pocket.

    Article Snippet: E. coli RNAP core enzyme for cryo-EM and most in vitro assays was over-expressed from E. coli BL21(DE3) (Novo protein, Inc.) carrying p Ec ABC and pCDF- Ec rpoZ (Table S1) and purified as described .

    Techniques: Cryo-EM Sample Prep, Comparison, Translocation Assay, Sequencing

    (A) The nucleic-acid scaffold and the antisense RNA (asRNA) used for cryo-EM structure determination. (B) The cryo-EM map (left) and structural model (right) for TTC-hairpin complex. (C) The cryo-EM map for nucleic-acid scaffold. The left insert shows the map for the RNA duplex in the RNA exit channel and the right insert shows the superimposition of the base pairs (–3 to 1) of the RNA–DNA hybrid between TTC-hairpin (colored as in the scheme) and TTC-pause (gray). (D) RNA duplex in the RNA exit channel. The electrostatic potential surface of RNAP was generated using APBS tools in Pymol. (E) The detailed interaction of the RNA duplex with residues in the RNA exit channel. Spheres, the Cβ atom of polar residues in H-bond distance with the phosphate backbone of RNA duplex. (F) The interaction of the –11 base pair of RNA duplex with residues in the RNA exit channel. (G) Further extension of RNA duplex is blocked by RNAP β′ ZBD, β′ lid, and β Sw3 motifs. (H) The structural comparison of RNA exit channel between TTC-pause (gray) and TTC-hairpin (colored). (I) The global conformational movement of TTC-hairpin (colored) compared with TTC-pause (gray). (J) The comparison of the first three base pairs of the RNA–DNA hybrid between TTC-hairpin (pink and blue) and TEC (gray) (PDB: 6ALF). The two structures were superimposed based in the RNAP-β′ lid and rudder motifs. (K) The G (–10) of the tDNA is under the tunnel formed by RNAP-β′ lid and rudder and ready to pair with the –10 nucleotide of ntDNA.

    Journal: bioRxiv

    Article Title: Structural basis for intrinsic transcription termination

    doi: 10.1101/2022.08.30.505822

    Figure Lengend Snippet: (A) The nucleic-acid scaffold and the antisense RNA (asRNA) used for cryo-EM structure determination. (B) The cryo-EM map (left) and structural model (right) for TTC-hairpin complex. (C) The cryo-EM map for nucleic-acid scaffold. The left insert shows the map for the RNA duplex in the RNA exit channel and the right insert shows the superimposition of the base pairs (–3 to 1) of the RNA–DNA hybrid between TTC-hairpin (colored as in the scheme) and TTC-pause (gray). (D) RNA duplex in the RNA exit channel. The electrostatic potential surface of RNAP was generated using APBS tools in Pymol. (E) The detailed interaction of the RNA duplex with residues in the RNA exit channel. Spheres, the Cβ atom of polar residues in H-bond distance with the phosphate backbone of RNA duplex. (F) The interaction of the –11 base pair of RNA duplex with residues in the RNA exit channel. (G) Further extension of RNA duplex is blocked by RNAP β′ ZBD, β′ lid, and β Sw3 motifs. (H) The structural comparison of RNA exit channel between TTC-pause (gray) and TTC-hairpin (colored). (I) The global conformational movement of TTC-hairpin (colored) compared with TTC-pause (gray). (J) The comparison of the first three base pairs of the RNA–DNA hybrid between TTC-hairpin (pink and blue) and TEC (gray) (PDB: 6ALF). The two structures were superimposed based in the RNAP-β′ lid and rudder motifs. (K) The G (–10) of the tDNA is under the tunnel formed by RNAP-β′ lid and rudder and ready to pair with the –10 nucleotide of ntDNA.

    Article Snippet: E. coli RNAP core enzyme for cryo-EM and most in vitro assays was over-expressed from E. coli BL21(DE3) (Novo protein, Inc.) carrying p Ec ABC and pCDF- Ec rpoZ (Table S1) and purified as described .

    Techniques: Cryo-EM Sample Prep, Generated, Comparison

    (A) The asRNA-induced termination strategy used for obtaining the cryo-EM structure of TTC-release. (B) The results of RNA release assay show that asRNA12 induces release of nascent RNA in a time-dependent manner. T, total fraction; S, supernatant fraction. (C) The cryo-EM map and structural model of TTC-release. (D) The cryo-EM map and model of the nucleic-acid scaffold TTC-release. (E) The comparison of transcription bubble sizes of TTC-release and TTC-hairpin. (F) The rewound 5-bp dsDNA (–10 to –6) were loosely restrained by β protrusion, β′ clamp helices, and β′ rudder and further rewinding of the upstream dsDNA is stopped by the β lobe domain due to a closed clamp. (G) The in vitro transcription assay suggests that DNA unwinding is required for intrinsic termination at the λ tR2 terminator. Data are presented as mean ± SEM, n=3 biologically independent experiments. **P<0.01, ***P<0.001, ****P<0.0001. (H) RNA releases from TTC during termination faster than DNA releases. A TTC scaffold making all RNAP contacts with P label on the T strand 5′ O and RNA 3′ phosphodiester was immobilized on beads. Upon asRNA addition, the rate of RNA release was 0.037 ± 0.006 s −1 whereas DNA released at 0.0075 ±0.001 s −1 .

    Journal: bioRxiv

    Article Title: Structural basis for intrinsic transcription termination

    doi: 10.1101/2022.08.30.505822

    Figure Lengend Snippet: (A) The asRNA-induced termination strategy used for obtaining the cryo-EM structure of TTC-release. (B) The results of RNA release assay show that asRNA12 induces release of nascent RNA in a time-dependent manner. T, total fraction; S, supernatant fraction. (C) The cryo-EM map and structural model of TTC-release. (D) The cryo-EM map and model of the nucleic-acid scaffold TTC-release. (E) The comparison of transcription bubble sizes of TTC-release and TTC-hairpin. (F) The rewound 5-bp dsDNA (–10 to –6) were loosely restrained by β protrusion, β′ clamp helices, and β′ rudder and further rewinding of the upstream dsDNA is stopped by the β lobe domain due to a closed clamp. (G) The in vitro transcription assay suggests that DNA unwinding is required for intrinsic termination at the λ tR2 terminator. Data are presented as mean ± SEM, n=3 biologically independent experiments. **P<0.01, ***P<0.001, ****P<0.0001. (H) RNA releases from TTC during termination faster than DNA releases. A TTC scaffold making all RNAP contacts with P label on the T strand 5′ O and RNA 3′ phosphodiester was immobilized on beads. Upon asRNA addition, the rate of RNA release was 0.037 ± 0.006 s −1 whereas DNA released at 0.0075 ±0.001 s −1 .

    Article Snippet: E. coli RNAP core enzyme for cryo-EM and most in vitro assays was over-expressed from E. coli BL21(DE3) (Novo protein, Inc.) carrying p Ec ABC and pCDF- Ec rpoZ (Table S1) and purified as described .

    Techniques: Cryo-EM Sample Prep, Release Assay, Comparison, In Vitro, Transcription Assay